Introduction: Hearing loss has several consequences in older adults life's, affecting the quality of life, social participation, and cognition. Cochlear implants in this population improves speech comprehension, and cognition, and can be bilaterally, unilaterally, or bimodal. Objective: evaluate the outcomes of older adults CI users concerning speech perception, listening effort, quality of life, and cognitive screening. Our aim is to verify which factors significantly impact the quality of life of this population. Methods: Assessment of speech comprehension in silence and noise with HINT, cognitive screening with ACE-R, and quality of life with WHOQOL-OLD Results: There was no significant difference between comprehension scores in different CI adaptations in silence and noise. HINT silence had a negative correlation with age (ρ -0,6094; p-value <0,05), HINT fixed noise had a positive correlation with social participation (ρ=0,4481, p-value < 0.05). Lower subjective auditory effort in speech comprehension in noise was correlated with higher quality-of-life scores (ρ -0,4372, p-value <0,05). 27,27% of subjects were diagnosed with mild cognitive impairment, but cognition did not have a correlation with quality of life (p-value > 0.05). Conclusion: Speech perception in noise and subjective listening effort are important factors in evaluating the quality of life of elders with CI.

Introduction. Type 1 diabetes mellitus (T1D) is associated with a potential risk of negative interference in various aspects of the patient's osteometabolic physiology. Currently, there are few studies investigating the impact of T1D on bone mass acquisition in children and adolescents. Objective. To study and describe the pattern of bone mass acquisition in children and adolescents with T1D over a eight-year-period, by analyzing the bone mineral density of the lumbar spine and total body using bone densitometry (DXA). Methods. This was a longitudinal and retrospective study evaluating the pattern of bone mass acquisition using DXA in children and adolescents with T1D over an eight-year period, between 2009 and 2017, who were followed up at the Secretaria de Saúde do Distrito Federal. L1L4 lumbar spine Z-score (Zls) and total body Z-score (Ztb) of the same group of patients were evaluated in 2009 and 2017. At the end of the study, the patients were divided into two groups according to the length of time they had had T1D: Group A, with less than 10 years, and Group B, with more than 10 years of diagnosis. Anthropometric data (weight, height, body mass index - BMI), mean glycated hemoglobin (A1c), calcium intake profile, sun exposure, physical activity practice and number of fractures were the other variables assessed and correlated with the patients' bone mass acquisition pattern over the study period. Results. The study cohort consisted of 21 patients (13 females), with a mean age at the first assessment of 10.1 ± 2.9 years, and at the second assessment of 17.9 ± 2.9 years. The average time since diagnosis of T1D at the end of the second assessment was 11.0 ± 2.7 years. Group A (n = 8, 7 females, mean age of 16.5 ± 2.4 years at the end of the assessment period, a diagnosis time of 9.1 ± 0.8 years), presented a height Z-score (Zh) of -0.40 ± 0.60 SD, a BMI Z-score (Zbmi) 0.9 ± 0.6 SD and a mean A1c 8.0 ± 1.4 %. Group B (n = 13, 6 females, mean age of 18.8 ± 2.9 years at the end of the study period, time since DM1 diagnosis of 13.0 ± 2.4 years), presented Zh -0.19 ± 1.25 SD, Zbmi 0.01 ± 0.63 SD and mean A1c 9.2 ± 1.8 %. For the total group, there was a decrease in Zh over time, from 0.35 ± 1.22 to -0.2 ± 1.1 SD (p = 0.000), and an increase in Zbmi from -0.37 ± 0.78 to 0.35 ± 0.87 SD (p = 0.043). There was no change in mean A1c over the period (8.70 ± 1.74% and 8.7 ± 1.7%, respectively, p = 0.902). Over the study period, the Zls of the total group decreased from -0.04 ± 0.95 to -0.43 ± 1.23 SD (p = 0.032). There was no difference in Ztb (p = 0.292). There was no difference in behavior in the pattern of bone acquisition and mass and in the average A1c (p = 0.135) over the period, when comparing groups A and B. In the total group, there was a moderate negative correlation between mean A1c and Zcl (r² = -0.504; p = 0.023). Five patients in the total group had fractures (4 maleS), all traumatic and non-vertebral. None of the patients had clinical osteoporosis. The group of patients with fractures showed greater variation between the beginning and end Zls and Ztb compared to the group without fractures (p = 0.023 and 0.001, respectively). For the total group, there was a positive correlation between the pattern of sun exposure and Zls (p = 0.036). However, there was no difference in the pattern of Zls acquisition between the sexes (p = 0.273), nor was there any correlation between Zls and calcium intake (p = 0.274) or physical activity (p = 0.094). There was no correlation between the total body Z-score and the parameters analyzed. Conclusion. In this eight-year longitudinal cohort, there was a worsening of bone mass in the lumbar spine, a drop in Zh and an increase in Zbmi in children and adolescents with T1D, regardless of gender or disease length. Patients with higher A1c values showed greater impairment in the acquisition of bone mass. The occurrence of bone fractures was associated with greater negative variations in the bone mineral density of the lumbar spine and total body over the period.

Introduction: Diabetes mellitus is a group of metabolic diseases primarily characterized by hyperglycemia. A series of changes occur in the dental pulp of diabetic patients, including points of calcification. Objective: This systematic review evaluated the influence of diabetes on pulp calcification. Methodology: Searches were conducted in the databases: PubMed, Embase, LILACS, Web of Science, and Google Scholar. Based on the results, studies that assessed the influence of diabetes on pulp calcification were included. The next step was to evaluate the risk of bias using the tools: JBI Appraisal Checklist, SYRCLE’s Risk of Bias, and The Quin. A meta-analysis was performed with three cross-sectional observational studies to assess the prevalence of pulp calcification in diabetic patients compared to the control group. Results: Of the 2,269 studies identified from the databases, 9 studies were included in this systematic review. The included studies involved various types of studies: one in vivo, three in vitro, four observational, and one that combined in vitro and in vivo methodologies. The meta-analysis results indicate that the probability of developing pulp calcification is 5.19 times higher in diabetic patients. Conclusion: It is concluded that diabetes acts as a risk factor for the development of pulp calcification in diabetic patients.

The study deals with the monitoring and evaluation process in distance learning courses on arboviruses aimed at primary school teachers. Considering health education and communication as crucial in the prevention and control of arboviruses, dengue, zika and chikungunya, the course used these contents and methodologies capable of strengthening the relationship between health and education, turning basic education schools into teaching environments that propagate knowledge and practices for the control and prevention of arboviruses. The qualitative and quantitative methodologies described and analyzed 119 questionnaires applied to graduates from June to August 2021, in four dimensions. The results highlight the assertiveness of the choice of content, methodologies and use of technologies as facilitators for continuing health education.

The periodontal condition of pregnant women has been the focus of several studies carried out in Periodontal Medicine, due to some scientific evidence that points to a probable association between periodontitis and gestational outcomes. However, there is still no consensus for the diagnosis of periodontitis, making the reliability and comparability of epidemiological studies difficult. OBJECTIVE: To assess the accuracy of diagnostic criteria for periodontitis in pregnant women. METHOD: Had two parts. In the first one, a Systematic Review was carried out with studies of the accuracy of the different criteria for the diagnosis of periodontitis in pregnant women. Indexed articles that met the eligibility criteria in the main health literature databases were selected. The descriptors used in the search strategies were pregnant women, data accuracy, sensitivity, specificity, and validation studies. There was no language or publication date limitation. Verification of the existence bias inherent to the accuracy studies and assessment of the quality of evidence were performed. The second part comprised a validation study carried out with pregnant women who underwent prenatal care and sought care at three public hospitals in northeastern states: Bahia and Pernambuco. Participants were classified according to the presence and severity of periodontitis, according to proposed criteria, namely: 1) Page and Eke, 2007/2012, 2) Gomes-Filho et al., 2018, 3) Albandar et al., 2007, 4) Bassani et al., 2007, 5) López et al., 2002 and 6) Nesse et al., 2008. Taking the following criterion as the gold standard: 1) Gomes-Filho et al, 2018. Comparing the others criteria the diagnostic values were estimated: sensitivity, specificity, predictive values, likelihood ratio and their respective confidence intervals. RESULTS: They are presented in the form of 2 articles: 2) Systematic review, which included 4 articles and concluded that there is no standardization regarding the criteria used for the clinical diagnosis of periodontitis in pregnant women, with a wide variation in the prevalence of the disease according to each criterion adopted. 2) Original research article entitled “Different criteria for the clinical diagnosis of periodontitis in pregnant women: a validation study” with 1251 pregnant women. The results identified diagnostic criteria that can be recommended for screening and diagnosis of the disease, which should be chosen according to the research objectives and the characteristics of the population. CONCLUSIONS: In view of the panorama surrounding the specific characteristics of maternal periodontitis and the nonconsensual criteria existing in the literature for the diagnosis of this disease, the importance of standardizing the methods of diagnosing the disease is ratified, to contribute to the implementation of measures focused on the health of the pregnant woman and, therefore, of the newborn.

Aguardando formulário editável

Introduction: The novel coronavirus disease (COVID-19) was responsible for the increase mainly in the number of cases of hospitalized patients in a state of hypercoagulability and other hematological changes, having as a problem of deep vein thrombosis (DVT), in the intensive care unit (ICU). Objective: to present an analysis of the infectious process and incidence of Deep Vein Thrombosis in patients diagnosed with COVID-19, in addition to promoting criteria for early identification and detection of risks for clot formation. Methodology: this is a retrospective study carried out by analyzing the electronic medical records of 26 patients of patients with COVID-19 in the period between February and May 2021. patients with COVID19P and 10 patients with COVID-19 without the presence of DVT. Results: DVT was present in 61.54% of the patients evaluated with COVID-19, the age group ranged mainly between 40 and 59 years and males were prevalent in both groups. Regarding comorbidities, systemic arterial hypertension was present in 75% of patients who developed DVT, followed by obesity and diabetes mellitus. All patients evaluated in both groups had increased levels of CRP, ferritin and D-dimer. In the cogulogram, TAP and APTT showed alterations only in the group that corresponds to those who developed DVT. Conclusion: Thrombocytopenia was correlated with progression of COVID19 and development of DVT. The need for mechanical ventilation, the use of arterial and venous devices, the period of hospitalization, and the development of acute kidney injury requiring hemodialysis, demonstrated the impact that DVT has on hospitalized patients and its imminent increase in the risk of mortality when associated with COVID-19. Statistically, patients with COVID-19 associated with DVT are more likely to develop a severe clinical condition

Introduction: Health services have implemented major improvements for adherence to measures to prevent infections related to health care. Ventilator Associated Pneumonia (VAP) is among the most common infections in Intensive Care Units (ICU). Objective: To analyze the knowledge of health professionals about the Pneumonia Prevention Associated with Mechanical Ventilation bundle in the Adult Intensive Care Unit of a Teaching Hospital in the Federal District (DF). Method: quasiexperimental research of a quantitative nature. A questionnaire was applied to 93 ACU health professionals (physicians, nurses, physiotherapists, nursing technicians and dentists), with sociodemographic questions and about the items of the VAP prevention bundle, from August to October 2022. Results and Discussion: the overall average of correct answers was 74.6%. As for the level of education, it was identified that 62.4% of the participants had completed high school. With regard to training in continuing professional education, 81.7% of participants responded that they participated in events, lectures and courses; 92.5% of participants showed interest in receiving specific training on VAP; What they considered most important for improving learning in care about VAP prevention, 51.6% of health professionals answered permanent education; The difficulties indicated by health professionals to perform care on the prevention of VAP 39.8%, was the care in maintaining the position of the filter and trachea adequate; As for 19.4%, the most difficult thing is to perform the HO. Final considerations: Therefore, it is considered that bundles alone do not ensure the reduction of VAP rates, but should be implemented together with a group of actions with the same objective. Another point to be explored for other future studies is the financial impact of a bundle, to better demonstrate the institutional investment in VAP prevention.

In mid-2020, humanity faced one of the biggest pandemics in its entire history. The pandemic arising from the new coronavirus (COVID-19) has become one of the great challenges of the 21st century. It currently affects more than 100 countries and territories on five continents. Its impact remains invaluable, but directly and/or indirectly affects the health and economies of the world's population. It comprises of an infectious disease caused by the coronavirus related to severe acute respiratory syndrome through the SARS-CoV-2 virus. In 2019, in Wuhan, China, the first case of pneumonia caused by an unknown pathogen was described and reported to health authorities. On January 7, 2020, the first viral genome sequencing results were published and on January 12, China showed that the genetic sequences were shared with countries around the world and with the WHO through the Global Initiative on Sharing Database. All Influenza Data (GISAID). From these diagnoses, cases spread rapidly across the world, initially in mainland Asia, with cases reported in Thailand, Japan and South Korea. The virus was then imported to other countries and continents. Due to its high transmission power, Covid-19 promoted the development of scientific research aimed at studying efficient strategies to combat SARS-COV. In this sense, research has shown a very significant result of the effectiveness of microemulsions against a range of microorganisms, including bacteria, viruses, fungi and yeasts. Therefore, it is important to emphasize the great importance of microtechnology in the pharmaceutical, chemical and biological areas, making it possible to increase the bioavailability of therapeutic molecules, favoring interaction and biological potentiation. In this way, the present work aims to develop an innovative effervescent sanitizing device containing thymol particulate system, through the elaboration of a saponeic base through recycled oil and standardization, preparation of microemulsions, performance of DSC and Mev tests and elaboration of an innovative tablet of physical-chemical quality and microbiological and bacteriological efficiency. The method used in this work was analyzed using the High Performance Liquid Chromatography (HPLC) equipment, with the production of stock solutions in methanol, this solvent was used to enable the dilution of thymol because it is highly soluble in alcohol. Currently, a gap is noticeable regarding the presence of a specific literature regarding the tablet production process which was formulated in this work. Thus, the study was developed by carrying out tests which were chosen for better analysis of the formulations, taking into account the guidelines of the resolution of the collegiate board RDC n 59- 2010, which provides for the procedures and technical requirements of good practices for sanitizing products, the Brazilian Pharmacopoeia 6th Edition in the analyzes for tablets, as well as the scientific literature.

The present work was proposed to evaluate the viability of saliva as an alternative for detecting anti-SARS-CoV-2 antibodies. This work was divided into 2 studies. The first aims to evaluate the detection of anti-SARS-CoV-2 antibodies in saliva after vaccination using the rapid systematic review methodology. Fifteen studies were included, with approximately 1,080 saliva samples from vaccinated and/or convalescent individuals. Vaccines were mainly RNA-based, including recombinant viral vector vaccines as well. The techniques applied for the evaluation of salivary antibodies included ELISA assay, Multiplex Immunoassay, Flow Cytometry, Neutralization and Electrochemical assays. IgG, but not IgA, was frequently presented in saliva from vaccinated antiCOVID-19. Although antibody titers are lower in saliva than in serum, the results showed that saliva is suitable for antibody detection. The second study was of the longitudinal experimental type and aimed to evaluate the detection of anti-SARS-CoV-2 antibodies in the serum and saliva of vaccinated adults. 13 participants were included as a negative control and 35 participants vaccinated with two doses of the CoronaVac vaccine who subsequently received the Pfizer vaccine as a third dose. Vaccinated participants were evaluated after the second dose, one month and five months after the third dose, totaling 118 saliva samples. The ELISA assay was used to detect neutralizing antibodies (NAb), IgA and IgG. Also, electrochemiluminescence for detection of total antibodies (TAb) in 20 initial samples. TAb was detected in 10/10 samples in serum (158.13±88.1 U/mL) and only in 3/10 in saliva (0.63±0.46 U/mL) after the second dose. In serum, NAb was detected in 34/35 participants after the second dose (57.86±20.74%) and in 35/35 participants one month (95.6±3.34%) and five months (95.03 ±1.17%) after the third dose (p<0.0001). In saliva, NAb was detected in 30/35 samples after the second dose (6.54±5.54%), and in 35/35 samples one month (29.51±11.96%) and five months (10. 17±4.99%) after the third dose (p<0.0001). IgA was detected in 19/34 saliva samples after the second dose (1.46±1.01 ratio), 18/35 saliva samples one month after the third dose (1.71±1.65 ratio) and 30/35 five months after the third dose (2.69 ±1.72 ratio) (p<0.0013). IgG was detected in 1/34 saliva samples after the second dose (0.38±0.21 ratio), 33/35 saliva samples one month after the third dose (3.08±1.63 ratio) and 20 /35 saliva samples five months after the third dose (1.44±0.76 rare) (p<0.0001). There was a positive correlation between NAb and TAb in serum (r=0.6634), NAb in serum and IgG in saliva (r=0.7896), and NAb and IgG both in saliva (r=0.6115). Excellent sensitivity was observed for the salivary NAb test (95%). The salivary IgG test showed excellent sensitivity (100%) overall, excellent accuracy (100%) one month after the third dose, and still good accuracy (85%) five months after the third dose. NAb, IgA and IgG antibodies were found in the vaccinated saliva. In conclusion, studies have shown that anti-SARS-CoV-2 antibodies can be found in the saliva of individuals vaccinated for COVID-19.

Newborns in neonatal intensive care often require long periods of hospitalization and are subjected to several invasive therapeutic procedures, making them exposed to a number of adverse events. Quality improvement cycles have proven to be an important ally in preventing these events. Unplanned extubation (UE), understood as the accidental loss of the endotracheal tube (ETT) during mechanical ventilation or its exchange due to suspicion of obstruction or inadequate diameter, is considered the fourth most common adverse event in neonatal intensive care units (NICUs) in North America. Evidence on factors related to UE in neonatal intensive care and measures to prevent it are not well described in the literature. Thus, this study aimed to analyze the main intervention measures used in order to reduce UE in Neonatal Intensive Care Units. Thus, a systematic review of the literature was conducted. Original articles of randomized or nonrandomized clinical trial, quasi-experimental with control group, before-and-after without control group and interrupted time series types, which presented measures targeted at unplanned extubation prevention and whose outcomes were measured before-andafter intervention were searched in the following databases/journal portals: United States National Library of Medicine and National Institutes of Health (PubMed), Excerpta Medica (EMBASE), Scopus, Cumulative Index to Nursing and Allied Health Literature (CINAHL), Cochrane Library, Scientific Electronic Library Online (Scielo), Latin American Literature in Health Sciences (LILACS). Four reviewers, in a paired and independent manner, selected and evaluated the papers, and in case of disagreements, a fifth reviewer was consulted. The adopted search strategy retrieved 8,616 papers, of which 17 met the predetermined inclusion criteria. All included studies were before-and-after studies with no control group and interrupted time series. The main interventions directed at reducing UE were: presence of two or more clinical professionals while performing care or procedures on intubated patients; standardization and routine evaluation of ETT positioning; standardization of the ETT fixation model and routine evaluation of its integrity; documentation and review of all UE; signaling to increase team engagement or serve as a warning to intensify surveillance. The risk of bias of the selected studies was independently assessed by three reviewers using the NHI Assessment Tool for Before and After Studies, who pointed out a low methodological quality of the studies, mainly related to a lack of clarity regarding the eligibility criteria of participants, sample size, and statistical methods used. A positive relationship was identified between the adoption of intervention strategies and the reduction of UE, but more robust studies with more robust methodological quality are still needed to better determine the causal relationship of the outcomes with the interventions adopted.

Brain temperature variations are present in different neurophysiological functions and accompany pharmacological effects. One possible mechanism is changes in neurovascular coupling, which is the close relationship between neuronal activity and blood vessel volume with consequent variation in brain temperature. Ketamine (KET) and MK-801 (dizocilpine) are non-competitive glutamatergic NMDA receptor blockers. Both drugs produce similar electrophysiological effects, but with some marked differences, which may reflect differences in the mechanisms of action of these compounds. It is possible that the physiological and behavioral changes induced by NMDA channel blockers do not exclusively result from the pharmacodynamic interaction of these receptors, but depend on the correlated effects of brain temperature variation, correlates of brain electrical activity and cardiac function. In this study, we evaluated the physiological changes (intracerebral temperature, neural oscillations and cardiac activity) induced by these two drugs in rats anesthetized with isoflurane. Ten Wistar rats were used for analysis of temperature variation and cerebral oscillations, as well as cardiac function after acute administration of ketamine (30 mg/kg; n=5) and MK-801 (0.1 mg/kg; n= 5). The entire acquisition was performed after stereotaxic surgery for the insertion of a deep electrode in the CA1 region of the hippocampus together with the temperature sensor. A screw in the subdural region contralateral to the electrode was positioned for acquisition of the most superficial activity, and one in the cerebellum was used as a reference. A system (equipment and computer program) for measuring temperature in biomedical experiments was developed in the present work, as well as its validation in in vivo experiments. In addition to the apparatus, a protocol for acute measurement of temperature and brain electrical activity along with cardiac activity was established in the laboratory. From the acquisitions it was possible to observe that the brain temperature in anesthetized rats is lower than the body temperature, which is different in awake larger mammals. As well as corroborating with previous studies that brain temperature suffers small fluctuations when compared to body temperature, which is more homogeneous over time. It was confirmed that NMDA antagonists have a great influence on the dynamicity of brain rhythms and their administration in both cases decreased the animals' beats per minute. Finally, the acquisition approach of three physiological variables proved to be a metric with greater possibility of analysis at the systemic level of how drugs such as ketamine and MK-801 act.

Introduction: Recently, a new "metabolic classification" was proposed for prolactin, and based on it, hypoprolactinemia and hyperprolactinemia were defined as results approximately < 7 and > 100 ng/mL, respectively. Various metabolic diseases have been associated with this range of results, however, the determination of the cut-off points that influence metabolism seem uncertain. Objectives: To investigate the possible correlation between prolactin concentration and glucose and lipid metabolism tests. To establish a "gray zone" that represents the inflection points, associating the results of the glycemic and lipid metabolism tests with prolactin. As part of the study, a machine learning tool was created using the R language to perform these analyses in an automated way. Methods: A cross-sectional study was conducted with 65,795 laboratory results from adult patients of both sexes, collected in the first half of 2018 at the Sabin Laboratory. The data, extracted and anonymized from the Laboratory Information System, included lipid parameters (total cholesterol, HDL-c, LDL-c, triglycerides) and biochemical/hormonal parameters (glucose, prolactin, insulin, HOMA-IR). Individual data were stratified into 106 partitions, based on the average concentrations of prolactin and lipid and glycemic metabolism analytes of each individual. These averages were used in three analyses: (1) in the comparison of the results of the glycemic and lipid metabolism tests in each range of the new metabolic classification of prolactin, (2) in the estimation of the inflection point through a machine learning model and the "gray zone" that represents the equivalent inflection points, associating the results of the glycemic and lipid metabolism tests with prolactin, and (3) in the prediction of the average results of these glycemic and lipid metabolism tests from the estimated inflection point. In addition, individual prolactin results were used to compare prolactin concentrations between sexes. Results: The analyzed population was aged between 21 and 75 years, composed of 51,366 women and 14,429 men. Hyperprolactinemia (prolactin concentrations above 25 ng/mL) was identified in 4,004 of the 51,366 women (7.79%) and in 208 of the 14,429 men (1.41%). Prolactin results were equivalent between sexes. The average results of the glycemic and lipid metabolism tests were significantly higher in the range of average prolactin results < 7 ng/mL. In the HomeoFIT-PRL range, corresponding to the range of the median and the distribution of the average results of the glycemic and lipid metabolism tests are predominantly lower compared to the other ranges of average prolactin results. Below the "gray zone" represented by the average prolactin results between 9.58 and 12.87 ng/mL, there may be impairments in glycemic metabolism, while for lipid metabolism, the estimated "gray zone" was 13.81 to 18.73 ng/mL. Conclusion: Our research confirms the correlation between variations in average prolactin concentrations and glycemic and lipid metabolism tests in humans, suggesting a mediating role of prolactin in the pathogenesis of impaired glucose and lipid metabolism. However, the cross-sectional nature of the study limits causal inference. Prospective studies with large data volumes and appropriate statistical approaches are needed to clarify the causeeffect relationship. The historical average of prolactin concentrations may offer more precise insights for understanding metabolic homeostasis. 

Rhipicephalus (B.) microplus, popularly known as “carrapato-do-boi”, is the species that most compromises cattle breeding productivity in the country. Additionally, this parasite has a major negative impact on commercial, environmental, and public health. Nowadays, several strategies are available for controlling, preventing, and eliminating agricultural pests and other pathogenic microorganisms such as bacteria and fungi. In this way, applying formulations with innovative multifunctional devices based on essential oils (OEs) has been finding great efficiency in combating these etiological agents, mainly the Syzygium aromaticum essential oil (OESA). This work aims to obtain and characterize an innovative multifunctional device based on microemulsions containing the essential oil of S. aromaticum, dispersed in a saponeic base developed by a saponification reaction. It is expected that such system, when in contact with the aqueous medium, releases eugenol, an active ingredient of OESA and responsible for controlling agricultural pests due to an extensive acaricidal, bactericidal, and fungicidal action. The methodology was developed based on an experimental design study, including a pseudo-ternary phase diagram, the formulation selection, the development and physical-chemical characterization of the microemulsion, the production of a soap base, and the evaluation of acaricides and microbiological activity. The results obtained demonstrated that all three formulations remained with adequate viscosity, yellowish, clear, and translucent. Among the developed formulations, formulation 02 (ME25, 2:8:6 OESA: T/Cot: water) was chosen for the other tests due to its promising characteristics. The results indicated PDI values lower than 0.3, demonstrating an excellent homogeneity in the droplet diameter distribution. The zeta potential varied between -27.1 and - 39.9 mV. The selected formulation had a pH of 8.50. The soap base presented a semi-solid appearance, even after drying, compromising the tableting process. As for the acaricidal activity, using OESA, pure, and in the microemulsion significantly inhibited the posture of the engorged females, demonstrating an effectiveness of almost 100%. As for the larval forms, the group containing pure and microemulsified OESA resulted in mortalities above 99% and 95%, respectively. The microbiological evaluation showed an antimicrobial activity for both pure and microemulsified essential oil, classified as strong inhibitors, as they had a Minimum Inhibitory Concentration (MIC) of up to 500µg/mL. Thus, it is concluded that the microemulsion containing the essential oil of S. aromaticum was obtained satisfactorily, proving to be adequate in its physicochemical aspects. Furthermore, both the essential oil itself and the microemulsion showed capable of combating the species Rhipicephalus (B.) microplus, suggesting an excellent acaricidal activity, in addition to a satisfactory antimicrobial activity, requiring further research and experiments to elucidate the mechanisms of action of the compound.

L-asparaginase is an enzyme used for the treatment of Acute Lymphoblastic Leukemia, which mostly affects children and teenagers. Currently, Brazil imports L-asparaginase without National Health Surveillance Agency registration, making it important to have a national production of this enzyme and the need to search for alternative production methods. One alternative would be cloning and expressing L-asparaginase from Fusarium proliferatum in Escherichia coli, with the aim of obtaining higher enzymatic productivity and reducing production costs. Another important factor would be the attenuation of adverse effects caused by treatment with enzyme obtained from prokaryotic sources, since Fusarium proliferatum is an eukaryotic microorganism. Therefore, the objective of this study was to clone L-asparaginase obtained from Fusarium proliferatum and express it in Escherichia coli BL21(DE3). The L-asparaginase gene from Fusarium proliferatum was identified and synthesized in pET-28a(+) vector with codon optimization for E. coli and NdeI/XhoI restriction sites. The vector was then transformed for replication in E. coli DH10B, with subsequent transformation for expression in E. coli BL21(DE3). After confirming the insertion of the vector in the expression system, clones were selected for evaluation of L-asparaginase production. SDS-PAGE and Western Blot were used to select the clone with the highest enzyme expression, followed by evaluation of the best cell lysis method. Once the clone and the most efficient cell lysis condition were defined, screening was performed to optimize cultivation conditions, varying the IPTG inducer concentration, post-induction time and induction temperature.The soluble and insoluble fractions were used for enzymatic assay, where asparaginase activity was measured by Nessler and ß-hydroxamate aspartic acid methods.

Introduction: Hearing impairment is one of the main disorders that can interfere with the development of speech and language. In an individual can cause significant communication difficulties, social isolation, negativo fcelings and depressive disorders. The Ilearing Aids (11As) and Cochlear implant (Cl) are options for profound and sevcre hca ring loss, and the Cl can he indicated for individuais who do not obtain benefits from IlAs. Objective: To evaluate the quality of life of individuais who underwent sequential bilateral cochlear implants (C1s) with a long surgical interval between procedures. Methods: Fifteen patients, ages 8 to 70, who underwent sequential bilateral CI, with an interval equal to or greater than 4 years between surgeries, were evaluated. Quality of life was evaluated using three questionnaires: WHOQOL - BREF, SSQ-12 and HHIA in Portuguese. Results: The WHOQOL-BREF questionnaire showed that the study participants had a good quality of life in ali domains tested. According to SSQ - 12, few reported inability to listen in communication situations. Most individuais were classified as having medium disability by the HHIA, but the social and emotional effects did not significantly affect the quality of life. Conclusion: The use of questionnaires to assess the quality of life of patients with hearing impairm ent is a valuable tool to measure adaptation to CI. Patients undergoing bilateral sequential CI, even with a long interval betwee n procedure s presented high indices of quality of life.

Patients with kidney failure on hemodialysis experience protein-energy wasting, loss of muscle mass and impaired physical function. Physical exercise during hemodialysis sessions appears to be a complementary therapeutic option to mitigate these characteristics. However, little evidence is available on long-term experience implementing this intervention as part of routine clinical practice. The present study aimed to investigate the feasibility of implementing a supervised intradialytic physical exercise program for patients on short-term daily hemodialysis. This is an observational, longitudinal and prospective study. Thirty-three patients were included. The physical exercise program consisted of a warm-up, lower and upper limb resistance exercises, lower limb cycle ergometer and cool down. Patients underwent the intervention during the first hour of hemodialysis, twice a week, supervised by physiotherapists and/or physical education professionals. Feasibility was assessed using the RE-AIM tool (Reach = Reach, Efficacy/Effectiveness, Adoption, Implementation, Maintenance) at individual and global levels.

“Introduction: Food consumption is not only driven by a desire for nutrients and satiety. Meals are also fundamental elements of human interaction and culture. While some patients in palliative care and terminality perceive nutrition as a hope for survival, others choose to stop eating and drinking voluntarily. Health professionals, caregivers, and family members are frequently involved in these situations. In this context, making decisions based on the best scientific evidence and the wishes of patients and families is essential. This review aims to obtain an overview of evidence-based knowledge and pinpoints existing knowledge gaps related to nutrition in palliative care and terminality to identify the actual knowledge regarding this topic and areas requiring further research. Methods: Data were retrieved from the Web of Science Core Collection on Octuber 2023, incluind articles published from January 2004 to September 2023. There was no language restriction. Bibliometrics and social network analysis were used to explore and map the knowledge structure, research hotspots, development status, authors, institutions, countries, journals, and development trends of nutrition in palliative care and terminality. The Bibliometrics, VOXviewer, Excel, and BibExcel software were used for the bibliometric analysis. Results: Two hundred eighty-nine articles were included, written by 1355 authors from 43 countries and published in 166 journals with an average of 5.2 co-authors per document and 22.2 citations per doc. The annual papers increased from four in 1994 to 35 in 2022, with a 2-year moving average of 29.5 between 2021 and 2022. “Healthcare Science & Services” were the most common WOS subject category. The United States contributed the highest number of articles. The keywords were stratified into sex clusters: "Comprehensive End-of-Life Care" (the largest category), "Advanced Cancer Nutritional Support", "Ethical Decision-Making in End-of-Life Choices", "Gastrointestinal Obstruction", and "Anorexia Nervosa". The trend topic analysis suggests an increase in the use of the terms related to patients' refusal of nutrition and artificial nutrition, assisted dying, anorexia nervosa, and eating disorders in the last years, shifting from the main themes, such as withdrawn and withholding Life-sustaining therapy in advanced cancer and dementia. Among the top 20 cited articles, although all papers addressed nutrition in palliative care and terminality in their content, it was the core element of the article in only nine papers. Conclusion: Even with the rising number of publications per year, the annual number of articles remains low, and the level of collaboration between countries and authors was found to be relatively low. Nutrition in palliative and terminal care has been little covered in journals specializing in nutritional therapy. It is worth mentioning that few articles evaluated perceptions surrounding the meaning of food in terminal illness, whether for patients or family members.

The use of 3D printing in the pharmaceutical area promises to revolutionize the drug therapy, having the complete customization of the dosage form as one of the main advantages of its use, with emphasis on the fused deposit modeling technique (FDM) that incorporates in its process technologies already used in the pharmaceutical industry, such as hot melt extrusion. With this technology the therapeutic possibilities have been expanded, since changes in the printing parameters can affect important characteristics of the drug, such as dosage and release profile. With the advances in this medicinal application of 3D technology, new aspects of therapy are being developed, such as the combination with other technologies of great impact, like nanotechnology. Nanotechnology has been demonstrating its impact for years in the pharmaceutical area, becoming even more important when polymeric materials associated with drugs are involved, due to the tendency of these materials to spontaneously form nanoparticles under certain dissolution conditions. With this, the present work aims to investigate 3D printing FDM as a reliable way to obtain pharmaceutical dosage forms and its correlation with nanotechnology, either by the spontaneous formation of the nanoparticles or by the inclusion of nanoparticles in formulations that will be printed. The first part of the study evaluated the impact of the 3D printing parameters in obtaining drug prototypes, highlighting the need for validation protocols to incorporate the technology in drug production. The second part of the study investigated the spontaneous formation of nanoparticles by the dissolution of 3D-printed tablets formulated with three different polymers and using naringenin as the model drug. The result demonstrated the formation of the particles in all the tested polymers, encapsulating a considerable amount of the drug, demonstrating the necessity to understand this process as a way to predict how these particles may affect the oral drug absorption. Finally, future perspectives are the incorporation of iron oxide nanoparticles into an oral pharmaceutical form made by 3D printing, investigating their dissolution process and the possibility of their use for the oral treatment of iron deficiency.

Introduction: the impact of voice problems in singers will be completely different from that to individuals with low vocal demand. For artistic voices, association between quality and demand is the most important aspect for a long-lasting career. Singers can be exposed to periods of long physical and vocal effort, increasing the risk of fatigue. Objective: The aim of this study is to contribute to the analysis of the relationship between low-level laser use and vocal fatigue. Methodology: 33 individuals took part in the study, 15 female and 18 male professional singers aged between 22 and 58. The participants did not have any self-reported vocal pathologies or injuries detected in otorhinolaryngological examination. In addition, they did not have any contraindications for laser therapy. Before singing, participants were randomly divided into three groups: the first was submitted to low-power laser, with red and infrared wavelengths, with a dose of 5J in 5 points of the larynx; the second was submitted to placebo laser therapy, and the third received no laser therapy. All participants answered the vocal self-assessment protocols: Modern Singing Handicap Index (IDCM) and Vocal Fatigue Index (IFV). Within 60min, they sang at high intensity in three moments of 15 minutes each, with a 5-minute break between them. After singing, they responded to the EASE-BR protocol at three times for 24 hours. Results: Participants who received laser had a lower EASE-BR score and an increase in maximum phonation time (MPT) in comparison with the groups that received placebo and no-laser therapy. No statistically relevant differences were found in the IFV and IDCM questionnaires. Conclusion: The study showed that the low-power laser had beneficial results regarding vocal fatigue, since the participants who received the laser obtained immediate post-performance results superior to those from groups that did not receive it, based on the analysis of the EASE-BR and MPT. However, the application of the laser in higher doses is suggested for comparison purposes, and in order to obtain ideal dosimetry.

The invasive lobular carcinoma, a special type of breast cancer, represents about 10% of this organ carcinomas. Associated to BRCA2 and CDH1 genes mutations, has a discohesive cellular phenotype, as a result of CDH1 gene pathogenic variants, which codifies E-cadherin adhesion molecules. Germline pathogenic variants are highly frequent in patients harboring Hereditary Diffuse Gastric Cancer syndrome and hereditary lobular breast cancer, in a dominant autosomal heritage and incomplete penetrance patternMore than 90% of them express estrogen and progesterone receptors, typically have low Ki67 and do not express HER2, belonging to the Luminal A molecular subtype, exhibiting a good prognosis when treated in the same way as non-special type carcinoma. Although there is currently no specific treatment for lobular carcinomas, there is pre-clinical description of increased ROS1 expression and synthetic lethality between E-cadherin deficiency and ROS1 tyrosine kinase inhibition, using ROS1 tyrosine kinase inhibitors, which results in apoptosis. However, there is no data in the literature correlating ROS1 expression in human tumors with E-cadherin expression and clinical-pathological data. The objective of the study was to analyze the potential of ROS1 expression, by immunohistochemistry, as a prognostic marker and to correlate the findings with "in silico" data from transcriptomes of CLIs in international open databases. This was an experimental cross-sectional study, approved by CEP/FS-UnB, with 79 cases of CLI, from the archives of two private and public institutions in Brasília, between 2015 and 2019. The mean age of the patients was 58.9 years, with data such as laterality, location, and multicentricity similar to those already described in the literature. ROS1, the main biomarker of the study, was expressed in only 3 cases, having H-scores ranging from 15 to 240. All three had Ki67 greater than or equal to 20% (P=0.026) and estrogen receptor expression in less than 20% of neoplastic cells (P=0.000015). No statistical significance was found between the pattern of ROS1 expression and histological type, histological grade, lymphovascular invasion, margin status, lymph node stage, TNM stage, progesterone receptor expression (PR), HER2 overexpression or low expression, or E-cadherin or p120-Catenin expression pattern. Despite the small number of cases with ROS1 expression in the study, suggesting a different cellular homeostasis pattern between humans and rodents, the correlation with higher rates of cell proliferation may correspond to a worse prognosis for patients who present it. The second arm of the study, correlating with "in silico" data, is ongoing and will be presented in a complementary manuscript.

Herbs are used for tea preparation, and as material for phytotherapy medicines, and both are largely used by the population. However, they may contain contaminants and residues that may pose a risk health to consumers, and their levels should be monitored. In this work, UHPLC-MS/MS methods for multiresidue analysis (MMR), ethylenebisdithiocarbamates (EBDC, mancozeb and metiram), a subclass of the dithiocarbamates fungicides, and its degradation product ethylenethiourea (ETU), responsible for chronic toxicity of the EBDC, were validated in different dry herbs. The extraction of samples in the MMR method is performed with acidified acetonitrile (ACN), magnesium sulfate (MgSO4), and sodium acetate (CH3COONa), followed by purification by dispersive solid-phase with secondary primary amine (PSA). Sample preparation for determination of EBDC includes complexation with EDTA in alkaline medium, derivatization to form EBDC-dimethyl using dimethyl sulfate solution in ACN, followed by addition of MgSO4, sodium chloride (NaCl), and PSA. In the ETU method, samples are extracted with ACN, adding L-cysteine, followed by MgSO4, NaCl, and PSA. A mixture of seven plants, which are composed by flower, leaf, stem and/or bark, was used as control for the validation of the methods, which were applied to analyze samples of 33 different herbs. MMR was validated for 65 pesticides, and the limit of quantification (LOQ) ranged from 0.05 to 0.025 mg/kg; 35% of the 75 samples analyzed were positive (≥ the limit of detection, LOD) for at least one pesticide, with carbendazim (up to 1.602 mg/kg), and imidacloprid being the most detected (38.7 and 30.7% of positive samples, respectively). Mancozeb was used to validate the EBDC method, with a LOQ of 0.03 mg/kg (0.02 mg/kg CS2); 16.5% of the 103 analyzed samples were positive (≥ LOD, up to 1.05 mg/kg or 0.59 mg/kg CS2). None of the 89 samples analyzed for ETU (LOQ of 0.03 mg/kg) were positive. Only two of the analyzed pesticides are registered in Brazil for use in the investigated herbs (linuron in chamomile, and methomyl in black mulberry), indicating that good agricultural practices are not being applied in herb cultivation. The daily intake of pesticides through the consumption of the dry herbs analyzed represent a maximum of 5% the pesticide acceptable daily intake (fenitrothion, arnica), which does not represent a potential risk to consumers. In this work, methods for the analysis of pesticide residues in dry medicinal herbs were satisfactorily validated and can be applied to the analysis of different herb types. 

“The therapy used for the physical transition in gender dysphoria is the Transsexualizing Hormone
Therapy, which leads to the acquisition of secondary sexual characteristics of the sex with which the
user identifies. To carry out a systematic survey of the literature in order to establish
recommendations based on the available evidence regarding hormonal drug therapy and nonhormonal
adjuvants used in the transsexualization process for transgender men and women over 18 

years of age. The work is of paramount importance for health professionals who work with this
population because it outlines a profile through a systematic review by formulating three questions,
namely: what are the inclusion and exclusion criteria for starting hormone therapy, what are the
laboratory tests that should be monitored and the immediate and late adverse effects that hormone
therapy can bring to this population of trans men and women. The search was structured in order to
answer three questions and was carried out from 01/01/2004 to 08/23/2020), in the following
databases: G-I-N, Medline (via PubMed), Embase and Cochrane. Among the 73 articles found, 51
were excluded in the process of removing duplicates, leaving 682. Of these, 499 were excluded
when reading the abstract because they fit the exclusion criteria. 183 articles were read in full and
121 were excluded. Only 62 articles met the inclusion criteria and these 43 were about the trans men
population and 42 about trans women. The evidence is still limited, due to the low quality of the
studies. The criteria for initiation of therapy involve correct diagnosis, ability to adhere and the
absence of pathological conditions that contraindicate the use of transsexualizing hormone therapy.
The changes in laboratory tests of the trans woman were close to what was expected in the
population of cis women, and the changes of the trans man are similar to that of the cis man. The
studies did not identify an increase in breast cancer cases in users using transsexualizing hormone
therapy, as well as the occurrence of adverse events were considered few and mild, such as
hypertension, pain at the administration site and alteration of the cardiovascular epidemiological risk
profile and coagulopathies. Ideas for starting transsexualizing sex therapy are well consolidated by
consensus. The ideal conditions for starting transsexualizing sexual therapy are well established by
consensus. Regarding the periodicity and the expected changes, the results are still largely based on
the literature from the treatment of hypogonadism in cis people, making more follow-up studies of
the transsexual population necessary. Although the studies have found mild adverse events, few 

have lasted longer than 5 years, and more prolonged follow-up studies are needed, given that the
perspective is that the treatment will continue throughout the user's life.”

“ Introduction: obesity is a chronic disease that already affects a large part of the world population. The increase in its incidence consequently causes an increase in diseases related to it, such as hypertension and DM2. Adipose tissue malfunction and inflammation – also resulting from macrophage infiltration – have been identified as the main causes of these disorders. The crucial role that PPARγ plays in both the regulation of adipocytes and inflammatory genes in macrophages has already been demonstrated. Previous studies indicate that GQ-16, a PPARγ partial agonist, has insulin sensitizing effects comparable to those of the full agonist rosiglitazone, but without inducing weight gain. Aim: to determine whether the beneficial effects of GQ-16 extend to the antiinflammatory effects of full PPARγ agonists, in order to obtain a therapeutic option to prevent obesity-induced inflammation and the consequent insulin resistance. Methods: RAW 264.7 murine macrophages and 3T3-L1 preadipocytes were cultured in a contact and transwell coculture system with subsequent 24-hour treatment with vehicle (DMSO 0.001%), Rosiglitazone (10-5M) and GQ16 (10-5M), in the presence and absence of inflammatory stimulus with LPS (100 ng/mL). Differentiated 3T3-L1 and RAW 264.7 cultivated separately were used as control, which received the same treatments as the coculture. Cells were harvested with Trizol and the relative mRNA expression of inflammatory and adipogenic genes was analyzed by real-time quantitative PCR (RTPCRq). Results: with regard to inflammatory genes (IL-6 and TNFα), only IL-6 had its gene expression increased with LPS treatment in contact coculture, and this effect was abolished when in the presence of agonists. In most treatments, the expression of both genes was more pronounced in the coculture than in the control. In relation to adipogenic genes, LPS was able to increase expression of only aP2 and GLUT4 in contact coculture. In the case of aP2 expression, this stimulus was intensified by ROSI+LPS. In contrast, GLUT4 expression decreased when the agonists were in the presence of LPS, however, this was only seen in the control. ADPN had no effect on either the contact coculture or the control. The three adipogenic genes, in most treatments, were less expressed in the contact coculture than in the control. In the transwell coculture, LPS increased the expression of only IL-6 and ADPN, and rosiglitazone, in the presence of the inflammatory stimulus, decreased and increased, respectively, this expression induced by LPS. The gene expression of aP2 and GLUT4 showed a tendency to increase in the treatment with ROSI+LPS compared to LPS alone, and, in the case of GLUT4, the trend was also present in the treatment with GQ+LPS. Conclusion: the interaction between macrophages and adipocytes seems to have a fundamental role for the expression of inflammatory genes, but not for the expression of adipogenic genes. GQ-16, in addition to having a lower adipogenic effect compared to rosiglitazone, also seems to have some anti-inflammatory effect, but further studies should be carried out to confirm this statement. ”

Brazil is one of the largest consumers of pesticides in the world. Recent studies show that these substances can act as endocrine disruptors, causing adverse effects in the body, including adipogenesis which can lead to weight gain and contribute to the development of obesity. Recent unpublished studies by the research group which I belong identified that the pesticides ametryn and carbosulfan have adipogenic effects on 3T3-L1 cells and that carbosulfan promotes PPARγ activation, a key regulator of adipogenesis. Taking into consideration these results and the scarce knowledge about the endocrine disrupting effect of pesticides, studies that investigate this topic are extremely relevant. The aim of this work was to investigate, in mammalian cells culture, other mechanisms that may be related to the adipogenic potential promoted by the pesticides ametryn and carbosulfan. Considering the results previously obtained, a transfection and gene reporter assay using HeLa cells was carried out to evaluate if cysteine 285 was important for the activation of PPARγ promoted by carbosulfan and also to evaluate if the pesticides would promote activation of GRα, PPARα and β, TRα and β and PXR. To evaluate if the lipid accumulation promoted by the pesticides occurred via PPARγ, a cell differentiation assay using 3T3-L1 cells was performed during 15 days. The cells were treated with the concentrations of the pesticides that promoted lipid accumulation, in the presence or absence of T0070907, a specific PPARγ antagonist. A RT-qPCR was also performed to compare the expression of inflammatory genes in 3T3-L1 cells treated with ametryn or rosiglitazone, that is a well-known PPARγ agonist with anti-inflammatory properties. As a result, the presence of the mutation in cysteine 285 abolished the transcriptional activity promoted by carbosulfan suggesting that the cysteine is essential for its activation and that carbosulfan can mimic endogenous ligands. Regarding the receptors investigated, none of the pesticides promoted activation of GRα, PPARα and β and TRα and β. However, carbosulfan promoted PXR activation and can be considered its partial agonist. In the cell differentiation assay with the antagonist was observed that the co-treatment reduced the lipid accumulation promoted by the tested pesticides, suggesting that this accumulation occurs via PPARγ. Regarding the expression of inflammatory genes, ametryn decreased their expression and in its highest concentration, the decrease was similar to that promoted by rosiglitazone but it’s worth mentioning that a higher concentration of ametryn was necessary to promote this effect. The results of this work allow greater knowledge about some pesticides used in Brazil but more studies are needed to understand their effects on complex organisms.

Infantile hemangioma (hi) is classified as a benign tumor of endothelial cells and affects a considerable portion of the infant population. Its manifestation can occur in a mild or more advanced form and, depending on the classification of the pathology, propranolol hydrochloride, the first-choice treatment, should be used to assist in the remission of hi. However, the systemic therapy used in pediatric patients can trigger several adverse effects in them, thus envisioning the need to develop topical formulations with this drug to reduce or even end these unpleasant effects. In view of the above problem, the present work is justified by the demand for new technologies for the management of hi that do not present unwanted effects in pediatric patients. Therefore, a development of nanostructured lipid carriers (ncl) with different sizes was proposed through a box-behnken predictive model using the microemulsion technique. The compatibility between the inputs involved in the production process was studied through the application of thermochemical analysis associated with centroid simplex experimental design. The nlcs were characterized in terms of average size, polydispersity index (pdi), zeta potency and encapsulation efficiency (ee). The performance of nanodispersions was evaluated according to release kinetics and permeation profile in vitro and in vitro studies in hbmec cells were conducted to evaluate the inhibitory potential of hi. As a result, nlcs of 500 and 900nm were obtained, with acceptable pdi given the difficulty in obtaining this type of formulation with low levels of polydispersion, and ee greater than 99.0%. The two formulations obtained controlled the release of ppl in 24 hours and its accumulation in the target tissue for topical therapy of hi. In addition, positive results of inhibition of cell proliferation were observed.

Amelogenesis imperfecta (AI) is a genetic condition characterized by quantitative and/or qualitative alterations of tooth enamel. AI can manifest in isolation or as a manifestation of some syndrome. In recent years, variants in 26 genes have been identified in cases of IA. The aim of this study was to carry out the clinical characterization and molecular diagnosis of four families with diagnostic hypothesis of autosomal recessive IA (AIAR) being followed-up in the Centro de Atendimento Odontológico de Doenças Raras, of the Hospital Universitário de Brasília. Clinical records were evaluated, blood from patients and families was collected for DNA extraction by the salting out method, and sent for exome sequencing. New variants were validated by Sanger sequencing. Sequences were analyzed on the Varstation® platform from Varsomics and Frankliin, Genoox. After signing the free and informed consent form, six patients from five families, previously diagnosed with hypoplastic AI, underwent molecular examination. Biallelic or homozygous variants in 3 different genes were identified. Variants in the LTBP3 gene (c.85_105delCTGCTGCTGCTGCTGCTGCTG, p. Leu29_Leu35del; c.3214C>T, p. Gln1072Ter) were detected in one patient who also had skeletal changes. Two patients with renal changes had variants in FAM20A, (c.343_362delTCGCTCCTGGCCAGCCAGGA, p. Ser115Glyfs*48 and c.406C>T, p. Arg136*; c.1112G>A, p. Trp371*); two sisters with isolated AI had a variant in RELT (c.3214C>T, p. Gln1072Ter); and in one patient no pathogenic variants were identified. The results of this study extend the knowledge of the orodental phenotype of patients with isolated and syndromic AI in Distrito Federal and the spectrum of variants in LTBP3, FAM20A and RELT genes. Furthermore, they highlight the importance of detailed phenotypic characterization, and of the multiprofessional team in the diagnosis of patients with AI.

“CONTEXT: Probiotics are live microorganisms of different species that can confer a benefit when ingested in a certain amount. Over the years, studies involving probiotics have developed to expand their use in areas such as disorders and allergies. On the other hand, studies in other areas of application are still needed so that probiotics can be used as an alternative intervention. As an example of this, there is an important question regarding giardiasis caused by protozoa of the genus Giardia. This disease afflicts populations around the world and sometimes alternatives that do not affect patients are necessary. Studies with probiotics have the potential for an alternative treatment of patients with parasitic diseases since their use promotes the balance of the intestinal flora, competing with the parasites and thus improving the condition of patients. However, most of the works that analyze this potential with probiotics are carried out in vitro or in vivo in Murine organisms. There are still few studies that analyze the effects of probiotics in humans affected with intestinal parasites. OBJECTIVE: To evaluate the use of probiotics as an alternative intervention for giardiasis in in vivo studies carried out with murines and whether it is possible to start human trials from that moment. METHOD: In this Systematic Review, eligibility criteria for inclusion of studies in the review were defined. Papers dealing with intestinal parasitic diseases were included, intervention studies with probiotics and in vivo studies with mice. Works that dealt with non-parasitic intestinal diseases were excluded; that do not use probiotics; who have co-intervention in the same group in their methodology; review studies and works that were not complete. The systematic review was registered in PROSPERO – International Prospective Register of Systematic Review. A definitive search was made in the databases on 02/17/2020 through a search strategy made with keywords found using the Mesh program in Embase databases; Lilacs; Livivo; Pubmed; Scopus; Web of Science and Gray Literature (Google Scholar; OpenGrey and ProQuest. EndNote web software, Rayyan QCRI were then used to assist in the management, removal of duplicates and selection of studies. To analyze the risk of bias for each study, the SYCLE checklist was used. The entire selection process was carried out by two reviewers (1R and 2R) independently and the third reviewer (3R) to break the tie when there is a disagreement between the first reviewers. Data from each article included in the selection steps were then collected by Reviewers 1 and 2 (1R and 2R) and these data were organized in a table to analyze the results found and the risk of bias in these studies.

Introduction: Duchenne Muscular Dystrophy (DMD) and Becker Muscular Dystrophy (DMB) neuromuscular diseases caused by dystrophin deficiency, with DMD being the most frequent in childhood. After the advent of ventilatory interventions and corticosteroid therapy, Dystrophic Cardiomyopathy (CD) became its major cause of mortality in DMD, but the diagnosis is still late due to its poorly symptomatic nature. The active search for CD may enable early cardioprotection and, consequently, a better prognosis, while research in curative therapies advances. Noninvasive imaging has already been consolidated as effective instruments of this evaluation. The validation of serum biomarkers as predictors can help in the detection and stratification of CD risk. Objective: to evaluate the correlation between the Type B Atrial Natriuretic Peptide (Pro-BNP) and the subclinical cardiac alterations measuredby EcoStrain in patients with Duchenne Muscular Dystrophy (DMD) andBecker (DMB) in a reference outpatient clinic for neuromuscular diseases. Methods: observational and analytical study of longitudinal and prospective design with children and adolescents with DMD and DMB followed at the Children's Hospital of Brasilia José Alencar - Federal District - Brazil. Medical records, clinical examination, electrocardiogram, laboratory tests, echocardiogram and Holter were performed, with intervention after the first tests, when indicated, and clinical reassessmentand with tests in two other times, during a mean follow-up of 12 months. Descriptive and association analysis, agreement and correlation was performed through the IBM SPSS (Statistical Package for the Social Sciences) program 23, 2015. The significance level used in the entire study was 5%. Results: The study included 28 boys (27 DMD and 1 DMB), with a mean age of 10.1 years, being more than 70% asymptomatic and without alterations in cardiovascular physical examination, 90% without functional alterations to conventional Echocardiogram and 93.75% with changes in the Longitudinal Global Strain (GLS). The Shortening Fraction (SF) and the Ejection Fraction -Teicholz (LVEF-Tz) decreased significantly throughout the study, the intervention did not change the parameters and there was no agreement between Pro-BNP and SGL, and this analysis was impaired by the absence of normal GLS values in the sample. Conclusions: The EcoStrain detected subclinical myocardial dysfunction in patients who were still very young, and there was no agreement with pro-BNP values. LVEF-Tz and SFdecreased significantly and the intervention did not alter echocardiographic parameters throughout thestudy.

Cell senescence is a biological response resulting from aging and chronic stress mainly characterized by a permanent state of cell cycle arrest. Evidence indicates that senescence can affect important functions of the dental pulp such as tissue defense and repair. This work evaluated possible morphological changes, in addition to the migratory and proliferative capacity and effects on the immune response of human dental pulp cells (CEP/UCB 4,714,331). Initially, the cells were treated with doxorubicin to induce senescence. Confirmation of induction was performed by β-galactosidase staining. Then, the morphological changes were evaluated through scanning electron microscopy, proliferation by counting cells not stained by trypan blue, and migration by the Scratch method. It was possible to observe morphologically an increase about cell size and a decrease in the number of cell extensions about morphology (p>0.03). Regarding proliferation capacity, a reduction of 36% at 24h and 35% at 48h (p<0.05) was observed, in addition to a decrease in migration capacity after senescence induction (p> 0.05). In this way, senescence was shown to be harmful to the proliferative and migratory capacity, in addition to affecting cell morphology

Music can be considered one of the most complex and multi-domain stimuli for the brain. Among the elements that constitute music, rhythm is a central and indispensable structure, as it orders the movement of musical patterns in time and provides support to other musical structures. Studies using neuromodulation techniques such as transcranial direct current stimulation (tDCS) have demonstrated changes in perceptual, cognitive and behavioral functions. Studies with musicians indicate that musical performance can be improved with the application of tDCS on regions such as the motor area and cerebellum. It is also inferred that tDCS may help to reduce the effects of age on cognition and brain activity. Considering these aspects, the objective of the present study was to investigate the effects of tDCS on the perception and rhythmic-musical production in elderly people with musical training. The study included 48 elderly people aged between 60 and 86 years, divided into two groups, 25 with musical training and 23 without musical training. Of the participants with musical training, 10 (40%) underwent stimulation by anodic tDCS in the cerebellum and 15 (60%) in the motor area (M1). Among the participants without musical training, 10 (43.48%) received stimulation in the cerebellar area and 13 (56.52%) in the motor area. The instrument used to identify the rhythmic nuances of the research subjects was the H-BAT test (Harward Beat Assessment Test). The following instruments were used to verify executive functions: MoCA, STROOP test, CANTAB battery tests - Cambridge Neuropsychological Test Automated Battery: MOT (Motor Screening Task) SWN (Spatial Working Memory), PAL (Paired Associates Learning). The SEQTAP (Sequential Finger Tapping Task) was used to track motor capacity/performance. The STROOP, SEQTAP and H-BAT tests were performed in two sessions, separated by a period of one week. Within each session, a pre and post-tDCS test of all tests was performed, with the exception of the MoCA, MOT, SWM and PAL tests. The tests were performed before and after stimulation by tDCS, applied for 20 minutes in the cerebellum and in the left motor area (M1). The results of the study revealed, in relation to executive functions, a mild cognitive impairment in most of the sample. Few benefits of tDCS were found in cognitive tests. Significant differences were concentrated in the group of individuals without musical training. Stimulation in the motor area apparently produced more significant differences compared to the cerebellar area. Regarding sensorimotor synchronization, the results suggest that tDCS produced a significant effect on the consistency and accuracy of synchronization rates verified from the MTT test, both for individuals with training and for participants without musical training. The possible effects were verified mainly in the motor area (M1). Regarding the rhythmic-musical perception, probable effects of stimulation by tDCS were observed in the two stimulated areas, and the effects resulting from cerebellar stimulation were mainly concentrated among participants without musical training. In comparison with the cerebellum, the motor area showed more satisfactory results from neuromodulation. Finally, regarding the learning of the motor typing task, the findings related to the SEQTAP test, the probable significant effects were verified mainly in individuals with musical training, with greater effect of stimulation in the motor area (M1). Future research with longitudinal profiles may represent an important format to increase data regarding the effects of stimulation by tDCS in the motor areas (M1) and cerebellum on the perception and rhythmic-musical production of elderly individuals.

Naringenin is a bioflavonoid found primarily in citrus fruits such as Citrus aurantium L. It has many pharmacological benefits, including anti-atherogenic, anti-inflammatory, and anti-cancer, but low oral bioavailability. Considering the possibility of a systemic antiinflammatory effect via the transdermal route, the aim of this work was to develop a transdermal film of chitosan containing naringenin and to evaluate the cutaneous permeation of the drug from it. A simple, accurate and selective HPLC method for determination of naringenin in formulation and in in vitro studies was developed and validated. In mononuclear cell assays, naringenin induced an increase in two antiinflammatory markers (IL-10 and TGF-β1) from 1,0 µg/mL. In addition, it could reduce the expression of IL-1β and the proliferation of T lymphocytes, which has a pro-inflammatory role. After verifying the compatibility of naringenin with chitosan by means of thermal analysis tests, DD≥75% chitosan films were prepared in acidic solution. Then, naringenin (0.5% w/w) was incorporated into the polymer solution, which was subjected to a drying process for 12 h at 60 °C. The films were characterized and the stability evaluated over 90 days. Thus, a flexible and thick chitosan film (0.04 µm) containing naringenin was developed, which demonstrated adequate homogeneity in the content tests, in addition to a rupture strength of 8.81 ± 0.18 N. Considering the content, the film remained stable for 30 days. Naringenin was progressively released to the physiological media following both first order (R² = 0.97) and Korsmeyer-Peppas (R² = 0.91) kinetics. When topically applied, the chitosan film could stimulate a constant and continuous diffusion of drug across the skin over 72 h. Indeed, the permeation flux of naringenin was 0.30 ± 0.01 µg/cm²/h, which means a concentration in the receptor solution 14-fold (p<0.05) higher than that provided by the drug solution used as a control. Therefore, the chitosan films containing naringenin demonstrated physical and organoleptic characteristics suitable for dermal use and could increase the phytochemical absorption through the skin. Thus, the developed film should be a promising alternative for the treatment of inflammatory conditions for prolonged periods by the transdermal route.

Issue: The findings in the literature indicate inconsistency in the complications caused by implant of electrodes in the cochlea; vestibular alterations and balance disorders are mentioned as the most likely. Purpose: To evaluate, in the literature, through the results of multiples vestibular function tests, the effects of cochlear implant surgery on postural stability in adult patients and to analyze. Hypothesis: From the PICO strategy, where Population focuses on adults, Intervention is cochlear implant surgery, Comparisons between implanted patients and Outcomes are the results of the assessment of cochlear function, the research question was formulated: Are there deficits in vestibular function in adults undergoing cochlear implant placement? Method: Systematic review based on cohort, case-control, and cross-sectional observational studies. Information sources: Databases between 1980 and 2021: PubMed, Cinahl, Web Of Science, Cochrane, and Scopus. Search strategy using Mesh terms: "Adult", "Cochlear Implant", "Postural Balance", "Posturography", "Cochlear Implant", "Dizziness", "Vertigo", "Vestibular Functional Tests" and "Caloric Tests". Populational Inclusion criteria: Studies with adult patients; Intervention: cochlear implant placement surgery; Comparison: Analysis of vestibular function with vestibular test results and pre- and postoperative symptoms; Outcome: Studies with at least one of the vestibular function tests: computerized vectoelectronystagmography (VENG), Vestibular evoked myogenic potentials (VEMPs), Caloric test, Video Head Impulse Test (VHIT), Head Impulse Test (HIT), Videonystagmography (VNG) and Static and Dynamic Posturography. Exclusion criteria: studies without records of pre- and postoperative data collection and studies with populations under 18 years of age. Screening based on the reading of abstracts and titles was performed independently by two reviewers. At the end, with the intermediation of a third reviewer, manuscripts were included. Risk of bias analysis, performed by two other authors, occurred using the JBI "Critical Appraisal Checklist". Results: Of the 757 studies, 38 articles met the inclusion criteria. VEMP was the most commonly used test by the studies (44.7%), followed by caloric test (36.8%), and vHIT (23.6%). Most studies performed more than one test to assess vestibular function. Conclusion: Among all vestibular tests investigated, the deleterious effects on vestibular function after cochlear implant surgery were detected with statistical significance (P<0,05) using VEMP and Caloric Test. Comparing abnormal and normal results after implant surgery, the vestibular apparatus was evaluated as abnormal results after cochlear implant surgery only in the VEMP test. The other tests analyzed maintained a mostly percentage considered normal results

Some systemic pathological conditions such as skeletal dysplasias can lead to craniofacial alterations and are potential risk factor for temporomandibular joint development (TMJ) and masticatory system functioning. Osteogenesis imperfecta (OI) is a skeletal dysplasia and is considered a group of rare genetic disorders characterized by different degrees of bone fragility and increased susceptibility to fractures. bone and deformity. Extra-skeletal manifestations such as ligament laxity, muscle hypotonia, malocclusion and dentinogenesis imperfecta are frequently observed and can affect the craniofacial complex. Although many OI patients present orofacial manifestations, disruption involving the TMJ and their possible functional consequences, as well as their impact on emotional and behavioral aspects, are poorly reported in the literature. This study had two objectives: (1) to evaluate the influence of OI and its treatment on TMJ development through the characterization of the trabecular bone in the mandibular condyle; (2) to assess the impact of orofacial alterations and OI severity on the Oral Health-related Quality of Life index (OHRQoL) of patients. For the first objective, fractal dimension (FD) analysis of the condyle region was performed on panoramic radiographs of 33 patients (2-17 years old) treated with disodium pamidronate and compared with a control group of 99 individuals without OI. Effect of cumulative pamidronate dose, duration of treatment, and age at treatment onset on FD outcomes were evaluated using a linear regression model with mixed effects. For the second objective, the Brazilian version of the Child Perception Questionnaire (CPQ) was applied to children and adolescents grouped by age (8- 10 and 11- 14 years old). The relationship between the OHRQoL index and its health domains, OI types of and the presence of orofacial manifestations was evaluated. FD in patients was significantly lower compared to healthy adolescents (p < 0.01). The mean FD in the study group was 1.23 (± 0.15), and 1.29 (± 0.11) among controls. There was no statistically significant difference in this result regardless of sex. The type of OI, age at treatment onset and duration of therapy were variables that had a statistically significant effect on FD. The OHRQoL index for patients between 8 and 14 years old was 6.89 ± 6.59. It was lower among OI type III patients (5.9 ± 5.47) than in type IV patients (6.88 ± 5.47). 8.77). The index was lower for children (6.59 ± 7.06) than for adolescents (7.4 ± 6.04). This study demonstrated that the bone architecture of the condyle may be altered in pediatric patients with moderate and severe forms of OI. Furthermore, pamidronate treatment seems to affect this natural history, making the trabecular bone structure of the condyle more complex. It also demonstrated that HoRQoL was similar in patients with moderate and severe OI. The oral symptoms domain is the most relevant for the index among patients aged 8 to 14 years. The perception of HRQoL among adolescents was worse than among children.

Introduction: The quantity and intensity of coronary lesions and left ventricular function are important factors in the prognosis of coronary artery disease (CAD), as demonstrated in studies carried out in the 70s and 80s of the 20th century. More recently, the concept of optimized drug therapy (OMT) and the use of metallic stents and later drug-eluting stents in percutaneous coronary intervention (PCI) procedures. A scientific study that evaluated the degree of coronary disease and left ventricular function did not show an improvement in the prognosis of CAD despite the institution of BMT and PCI with the use of stents.4 However, this study excluded patients with trunk injury from its target population. coronary artery disease and left ventricular ejection fraction below 30%. The novelty of this work consists in the lack of data on which type of population and which results (success, survival) are achieved in practice in the Health System of the Federal District. In addition, there is still disagreement about the best therapeutic strategy for CAD. The present study aims to evaluate the prognosis of patients with CAD treated at the public health service according to the severity of coronary disease and left ventricular dysfunction, being, therefore, a more adequate record of the incorporation of BMT concepts into clinical practice. and PCI with Stents, in addition to coronary artery bypass grafting in a general population. Objectives: The primary objective is to evaluate the mortality of patients with coronary artery disease, treated at the public health service of the Federal District. Methods: The records of the Hemodynamics Services of the Tertiary Public Hospitals of the Federal District from January 2013 to December 2015 will be reviewed to survey the target population of the study; individuals with CAD undergoing left heart catheterization with coronary angiography. The medical records of the patients will be accessed in the electronic medical record system and the reports of the coronary angiographies performed will be analyzed in terms of anatomical severity and left ventricular function. Statistical analysis: For clinical characteristics, the distribution of variables and their normality will be checked using histograms, scatter plots and the Kolmongorov-Smirnoff and Shapiro-Wilk tests. For comparison between the mentioned groups, the chi-square tests will be used for categorical variables and the analysis of variance (ANOVA) for non-categorical variables. Results:From January 2013 to December 2015, 7,392 individuals with CAD treated in the public health network of the Federal District underwent CCG. Of these, 750 had stable angina, 1,376 unstable angina, 1,401 acute myocardial infarction without STsegment elevation and 1,689 acute myocardial infarction with ST-segment elevation. One thousand six hundred and eighty-four individuals had diabetes mellitus (DM), 485 being insulin-dependent (IDDM) and 1,199 non-insulin-dependent (NIDMD). Smoking was present in 1,893 individuals, dyslipidemia in 1,084, systemic arterial hypertension in 3,745, family history of CAD in 616, obesity in 336 and atrial fibrillation (AF) in 177. Males predominated in the sample. Optimized drug therapy was the option for 4,642 (62.8%) individuals, of whom 2,786 (37.7%) had significant CAD. Percutaneous coronary intervention was the option for 2,179 (29.5%) subjects and coronary artery bypass graft surgery was the option for 571 subjects (7.7%). Mortality when comparing the type of treatment proposed showed no difference. Mortality was higher in individuals with extensive coronary atherosclerotic disease, regardless of the proposed treatment. Mortality was higher in diabetic subjects when compared to non-diabetic subjects. Mortality was higher in individuals in whom antiplatelet therapy was not adequately prescribed by current standards.Conclusion: Mortality was higher in individuals with extensive coronary artery disease, diabetes mellitus and in those in whom anti-platelet aggregation therapy was not adequate for their clinical condition. There was no difference in mortality when compared to the therapeutic modality adopted.

Inhibition of systemic inflammation has been a beneficial strategy in treating several noncommunicable diseases, which represent one of the major causes of mortality in the world. The Peroxisome Proliferator-Activated Receptors (PPAR) are interesting pharmacological targets, since they can act both through the metabolic and anti-inflammatory pathways. Morus nigra L. has flavonoids in its chemical composition with recognized antioxidant activity and often associated with anti-inflammatory activity. Therefore, this study aimed to evaluate the hydroethanolic extract of M. nigra leaves' ability to activate PPARs and promote anti-inflammatory effects in lipopolysaccharide (LPS)-stimulated murine macrophage cells. The leaf extract was prepared by cold maceration, and the chemical profile was obtained by HPLC-DAD. The cytotoxicity of the extract was tested by the MTT method on RAW 264.7 and HeLa cells. Activation of the PPAR  and γ, and the Tr was tested using the luciferase genereporter assay in HeLa cells. The anti-inflammatory capacity of the extract was evaluated after the treatment of LPS-stimulated RAW 264.7 cells. HPLC analysis revealed the presence of rutin (3.74 µg/mg) and isoquercitrin (5.92 µg/mg). Low extract cytotoxicity was observed for the tested strains. The extract showed agonist activity for both types of PPAR ( and γ), but its major compounds (rutin and isoquercitrin) did not significantly activate the receptor. The extract was able to reduce the production of nitric oxide, reactive oxygen species and the pro-inflammatory cytokine TNF-α. Treatment with the specific PPAR-α antagonist, GW 6471, was able to partially block the anti-inflammatory effect caused by the extract. Thus, possibly the anti-inflammatory effect of the extract can be attributed, at least in part, to the activation of the PPAR-α receptor, being the first study to evaluate the activation of this receptor by the extract of the leaves of M. nigra L.”

Chemotherapy-induced peripheral neuropathy (CIPN) is a clinical manifestation of several classes of antitumor drugs, such as platinum derivatives. Cisplatin is an antitumor widely used in oncology practice due to its ability to induce apoptosis in tumor cells as a result of the formation of platinum adducts in DNA. However, in neurons, cisplatin induces changes that will culminate in peripheral neuropathy, a set of symptoms characterized by being predominantly sensory and dose-dependent. Among these symptoms are paresthesia, sensory loss and neuropathic pain, which can be acute or chronic. These effects occur because the neurons of the dorsal root ganglia (DRGs) are the targets of these drugs. Given this, developing strategies aimed at protecting the nervous system is essential for CIPN treatment. Thus, the purpose of this work is to evaluate in vitro whether aqueous extract of Eugenia dysenterica leaves (plant from Cerrado popularly known as Cagaita) has a neuroprotective role in the CIPN model. These hypotheses are supported due to the antioxidant and anti-inflammatory activities of this plant, in addition to the neuroprotective effect already demonstrated in other neurotoxicity models. Thus, primary cultures of DRG cells from adult rats and neuron-like PC-12 cells were established, which were treated with E. dysenterica extract in the presence or absence of cisplatin. The effects of these treatments on cisplatin neurotoxicity were evaluated using the techniques of evaluating cell viability, quantification of calcitonin gene-related peptide (CGRP) release and quantification of total CGRP, quantification of mRNA for Superoxide dismutase 2 (SOD2) and NRF2, the release of Interleucin-1b (IL-1b), the synthesis of reactive oxygen species and the measurement of neurites. We observed that treatment with 30 µM cisplatin for 24 hours did not induce cell death in DRG cells, increased neuronal sensitization and induced oxidative stress in PC-12 cells, which were prevented by pretreatment with 30 µg/mL of E. dysenterica extract. Furthermore, we observed that cisplatin promotes increased IL-1b release, SOD-2 gene synthesis and inhibition of neurite outgrowth. On the other hand, treatment only with 30 µg/mL of E. dysenterica extract also does not alter the cell viability of DRG cells, IL-1b release and SOD-2 gene expression, however it reduces Nrf2 expression. Furthermore, we observed that the extract does not interfere with the cisplatin antitumor activity or its effect on neurites. We also observed that Nrf2/Keap1/ARE pathway activators, oltipraz and sulforaphane, induced neuronal sensitization. In summary, our data demonstrate that E. dysenterica extract can be a promising tool for the treatment of cisplatin-induced PN.